Searching journal content for PGC1α (as phrase) in full text.

Displaying results 1-10 of 31
For checked items
  1. Research:
    • Haoyong Yu,
    • Mingliang Zhang,
    • Yunqin Ma,
    • Junxi Lu,
    • Jiemin Pan,
    • Pan Pan,
    • Haibing Chen,
    • and Weiping Jia
    5-ALA ameliorates hepatic steatosis through AMPK signaling pathway J Mol Endocrinol 59 (2) 121-128, doi: 10.1530/JME-16-0260 first published on 31 May 2017
    ...PGC1α and CPT1α expression. Introduction NAFLD is the most common liver disease worldwide. It comprises a spectrum of disorders characterized by liver steatosis, with >5% of hepatocytes infiltrated by fat in individuals with no history of alcohol abuse or competing etiologies for hepatic steatosis ( ~~~
  2. Research:
    • Yajie Guo,
    • Junjie Yu,
    • Chunxia Wang,
    • Kai Li,
    • Bin Liu,
    • Ying Du,
    • Fei Xiao,
    • Shanghai Chen,
    • and Feifan Guo
    miR-212-5p suppresses lipid accumulation by targeting FAS and SCD1 J Mol Endocrinol JME-16-0179, doi: 10.1530/JME-16-0179 first published on 30 June 2017
    ...PGC1α ~~~
  3. Research:
    • Ting-ting Zhou,
    • Fei Ma,
    • Xiao-fan Shi,
    • Xin Xu,
    • Te Du,
    • Xiao-dan Guo,
    • Gai-hong Wang,
    • Liang Yu,
    • Vatcharin Rukachaisirikul,
    • Li-hong Hu,
    • Jing Chen,
    • and Xu Shen
    DMT efficiently inhibits hepatic gluconeogenesis involving Gαq signaling pathway J Mol Endocrinol JME-17-0121, doi: 10.1530/JME-17-0121 first published on 21 June 2017
    ...PGC1α (-), TGTCAGTGCATCAATGAGGGC; 192 fructose bisphosphatase 2 (FBP2) (+), ACCCGTTACGTTATGGAAAAGG; 193 FBP2 (-), GGCAGTCAGCATCGAGTTGAG; 194 FOXO1 (+), AAGTACAGATACGGCCAATCC; 195 FOXO1 (-), CGTAACTTGATTTGCTGTCCTG; 196 GAPDH (+), ACAGCAACAGGGTGGTGGAC; 197 GAPDH (-), TTTGAGGGTGCAGCGAACTT. 198 199 Intr ~~~
  4. Review:
    • Jaya Nautiyal
    Transcriptional coregulator RIP140: an essential regulator of physiology J Mol Endocrinol 58 (3) R147-R158, doi: 10.1530/JME-16-0156 first published on 10 January 2017
    ...PGC1α a transcriptional coactivator first identified and cloned in BAT by the Speigelman group (Puigserver et al. 1998), modulates a number of genes involved in these metabolic pathways and shares several gene targets with RIP140, the two coregulators antagonising each other’s actions (Hallberg et a ~~~
  5. Review:
    • Haihua Yang and
    • Linghai Yang
    Targeting cAMP/PKA pathway for glycemic control and type 2 diabetes therapy J Mol Endocrinol 57 (2) R93-R108, doi: 10.1530/JME-15-0316 first published on 18 May 2016
    ...PGC1α is a transcriptional coactivator that plays a central role in the regulation of energy metabolism (Liang & Ward 2006). In hepatocytes, PGC1α interacts with other factors such as FOXO1 (Puigserver et al. 2003) to increase the expression of gluconeogenic genes. On the other hand, insulin inhibit ~~~
  6. Review:
    • Christopher E Wall,
    • Ruth T Yu,
    • Anne R Atkins,
    • Michael Downes,
    • and Ronald M Evans
    Nuclear receptors and AMPK: can exercise mimetics cure diabetes? J Mol Endocrinol 57 (1) R49-R58, doi: 10.1530/JME-16-0073 first published on 22 April 2016
    ...PGC1α f sirtuins f exercise mimetics f diabetes Correspondence should be addressed to R M Evans Email [email protected] Abstract Endurance exercise can lead to systemic improvements in insulin sensitivity and metabolic homeostasis, and is an effective approach to combat metabolic diseases. Pharmacologi ~~~
  7. Research:
    • Diana Vargas,
    • Noriaki Shimokawa,
    • Ryosuke Kaneko,
    • Wendy Rosales,
    • Adriana Parra,
    • Ángela Castellanos,
    • Noriyuki Koibuchi,
    • and Fernando Lizcano
    Regulation of human subcutaneous adipocyte differentiation by EID1 J Mol Endocrinol 56 (2) 113-122, doi: 10.1530/JME-15-0148 first published on 7 December 2015
    ...PGC1α UCP1 TFAM CITED1 GAPDH 0 3 6 0 3 6 Differentiation days PGC1α UCP1 GAPDH EID1 Ctl siEID1/1 Ctl ity Empty EID1 D1 (– ity 0 3 D1 (– EID1 (–) EID1 (+) siEID1/1 siEID1/2 *siEID1/2 Empty EID1 Research D VARGAS and others Effects of EID1 in human adipocytes 56 :2 118EIEID1 PGC1α Figure 3 EID1 reduce ~~~
  8. Research:
    • Hayden Weng Siong Tan,
    • Arthur Yi Loong Sim,
    • Su Ling Huang,
    • Ying Leng,
    • and Yun Chau Long
    HC toxin (a HDAC inhibitor) enhances IRS1–Akt signalling and metabolism in mouse myotubes J Mol Endocrinol 55 (3) 197-207, doi: 10.1530/JME-15-0140 first published on 15 September 2015
    ...PGC1α ~~~
  9. Review:
    • Andrea Armani,
    • Vincenzo Marzolla,
    • Andrea Fabbri,
    • and Massimiliano Caprio
    Cellular mechanisms of MR regulation of adipose tissue physiology and pathophysiology J Mol Endocrinol 55 (2) R1-R10, doi: 10.1530/JME-15-0122 first published on 13 August 2015
    ...PGC1α ~~~
  10. Research:
    • Daniil V Popov,
    • Evgeny A Lysenko,
    • Tatiana F Vepkhvadze,
    • Nadia S Kurochkina,
    • Pavel A Maknovskii,
    • and Olga L Vinogradova
    Promoter-specific regulation of PPARGC1A gene expression in human skeletal muscle J Mol Endocrinol 55 (2) 159-168, doi: 10.1530/JME-15-0150 first published on 20 August 2015
    ...PGC1α ~~~
For checked items

Search Results

Next 10 » New Search

Modify Results

Citation format:
Results / page:
Results order:

This search

  • Alert me when new articles matching this search are published
  • Download all citations on this page to my citation manager

New Articles: issue in progress

  1. August 2017, 59 (2)
  1. Current Issue
  1. Alert me to new issues of Journal of Molecular Endocrinology

Most