Searching journal content for GPER (as phrase) in full text.

Displaying results 1-10 of 16
For checked items
  1. Research:
    • Raquel S Campello,
    • Luciana A Fátima,
    • João Nilton Barreto-Andrade,
    • Thais F Lucas,
    • Rosana C Mori,
    • Catarina S Porto,
    • and Ubiratan F Machado
    Estradiol-induced regulation of GLUT4 in 3T3-L1 cells: involvement of ESR1 and AKT activation J Mol Endocrinol 59 (3) 257-268, doi: 10.1530/JME-17-0041 first published on 20 July 2017
    ...spliced forms of ESR1 (ER-46 and ER-36) (Kang et al. 2010) and/or (3) G protein-coupled estrogen receptor (GPER1) (Prossnitz & Barton 2014). These extranuclear effects involve intracellular signals, such as activation of the PI3K/AKT pathway (Lucas et al. 2008, Garrido et al. 2013). ESRs are known ~~~
  2. Research:
    • Angelina Rafaela Debortoli,
    • Wender do Nascimento Rouver,
    • Nathalie Tristão Banhos Delgado,
    • Vinicius Mengal,
    • Erick Roberto Gonçalves Claudio,
    • Laena Pernomian,
    • Lusiane Maria Bendhack,
    • Margareth Ribeiro Moysés,
    • and Roger Lyrio dos Santos
    GPER modulates tone and coronary vascular reactivity in male and female rats J Mol Endocrinol 59 (2) 171-180, doi: 10.1530/JME-16-0117
    ...DOI: 10.1530/JME-16-0117 http://.endocrinology-journals.org 2017 Society for Endocrinology Printed in Great Britain Published by Bioscientifica Ltd. GPER modulates tone and coronary reactivity a r debortoli and others Research 1711802 59: AngelinaRafaelaDebortoli1, WenderdoNascimentoRouver1 ~~~
  3. Research:
    • Natalia Calvo,
    • Pedro Carriere,
    • María Julia Martin,
    • and Claudia Gentili
    RSK activation via ERK modulates human colon cancer cells response to PTHrP J Mol Endocrinol 59 (1) 13-27, doi: 10.1530/JME-16-0216 first published on 6 April 2017
    ...GPER ~~~
  4. Review:
    • Gregory S Y Ong and
    • Morag J Young
    Mineralocorticoid regulation of cell function: the role of rapid signalling and gene transcription pathways J Mol Endocrinol 58 (1) R33-R57, doi: 10.1530/JME-15-0318 first published on 7 November 2016
    ...-specific effects are conferred through the enzyme 11-hydroxysteroid dehydrogenase 2, cellular redox status and properties of the MR itself. Furthermore, not all aldosterone effects are mediated via MR, with implication of the involvement of other membrane-bound receptors such as GPER. This review will describe ~~~
  5. Review:
    • Russell A Prough,
    • Barbara J Clark,
    • and Carolyn M Klinge
    Novel mechanisms for DHEA action J Mol Endocrinol 56 (3) R139-R155, doi: 10.1530/JME-16-0013 first published on 23 February 2016
    ...-HEX from RBL-2H3 cells Mizota etal. (2005) G-protein coupled Gq/11 receptor Mouse spermatogenic GC-2 cells DHEA-S (1 nM) activated phosphorylation of ERK1/2, c-SRC, ATF1, and CREB Shihan etal. (2013) G-protein coupled hCASMC Inhibited activation of the AKT/GSK-3 axis Bonnet etal. (2009) GPER/GPR30 7 ~~~
  6. Review:
    • Sylvia C Hewitt,
    • Wipawee Winuthayanon,
    • and Kenneth S Korach
    What's new in estrogen receptor action in the female reproductive tract J Mol Endocrinol 56 (2) R55-R71, doi: 10.1530/JME-15-0254
    ...these events are identical or variant forms of the ER or instead distinct receptors altogether. One potential mediator of rapid membrane localized hormone response is the G protein coupled ER (GPER, originally referred to as GPR30), which is activated by E2 (Prossnitz & Barton 2011). Gper mice lack ~~~
  7. Thematic Review:
    • Evan Simpson and
    • Richard J Santen
    Celebrating 75 years of oestradiol J Mol Endocrinol 55 (3) T1-T20, doi: 10.1530/JME-15-0128 first published on 5 October 2015
    ...that impacts reactive oxygen species levels. These effects are thought to occur through the mediation of mitochondrial ERb. G protein coupled ER The G protein coupled ER (GPER; formerly known as GP30) is a novel ER with multiple functions in diverse tissues (Marjon et al. 2014). It responds to oestradiol ~~~
  8. Research:
    • Fernanda N Cavalcanti,
    • Thais F G Lucas,
    • Maria Fatima M Lazari,
    • and Catarina S Porto
    Estrogen receptor ESR1 mediates activation of ERK1/2, CREB, and ELK1 in the corpus of the epididymis J Mol Endocrinol 54 (3) 339-349, doi: 10.1530/JME-15-0086
    ...estrogen receptors ESR1 and ESR2 (also known as ERa and ERb respectively) and the G-proteincoupled estrogen receptor (GPER, GPR30) are present in the epididymis (Hess et al. 2011). Knockout of ESR1 (Esr1K/K) in the male mouse leads to the misregulation of acid/base transporters, failure of epididymal ~~~
  9. Research:
    • Yue Wang,
    • Xiu Long Niu,
    • Xiao Qin Guo,
    • Jing Yang,
    • Ling Li,
    • Ye Qu,
    • Cun Xiu Hu,
    • Li Qun Mao,
    • and Dan Wang
    IL6 induces TAM resistance via kinase-specific phosphorylation of ERα in OVCA cells J Mol Endocrinol 54 (3) 351-361, doi: 10.1530/JME-15-0011 first published on 5 May 2015
    .../ERK and phosphotidylinositol 3 kinase (PI3K)/Akt pathways (Schiff et al. 2003). Results of recent studies have indicated that the G-protein-coupled ER (GPER) mediates the non-genomic signaling of estrogen in a variety of estrogen-related cancers including OVCA (Albanito et al. 2007, Yan et al. 2013). Ge et al. (2013) have ~~~
  10. Research:
    • Ciro Menale,
    • Maria Teresa Piccolo,
    • Grazia Cirillo,
    • Raffaele A Calogero,
    • Alfonso Papparella,
    • Luigi Mita,
    • Emanuele Miraglia Del Giudice,
    • Nadia Diano,
    • Stefania Crispi,
    • and Damiano Gustavo Mita
    Bisphenol A effects on gene expression in adipocytes from children: association with metabolic disorders J Mol Endocrinol 54 (3) 289-303, doi: 10.1530/JME-14-0282 first published on 15 April 2015
    ...GCCAGCCAAAAAGCCATATAAC Reverse GGCATAGATCTTCTCCGGTTCA GPER Forward ACGAGACTGTGAAATCCGCAACCA Reverse ATCAGGCTGGAGGTGCACTTGGAA Leptin (OB) Forward TCACCAGGATCAATGACATTTCA Reverse CCAAACCGGTGACTTTCTGTTT FABP4 Forward TTGACGAAGTCACTGCAGATGA Reverse CAGGACACCCCCATCTAAGGT IL1B Forward CTGAGCTCGCCAGTGAAATG Reverse ~~~
For checked items

Search Results

Next 6 » New Search

Modify Results

Citation format:
Results / page:
Results order:

This search

  • Alert me when new articles matching this search are published
  • Download all citations on this page to my citation manager

New Articles: issue in progress

  1. November 2017, 59 (4)
  1. Current Issue
  1. Alert me to new issues of Journal of Molecular Endocrinology

Most