Searching journal content for TERT promoter mutations (as phrase) in full text.

Displaying results 1-10 of 24
For checked items
  1. Research:
    • Trisha Dwight,
    • Aidan Flynn,
    • Kaushalya Amarasinghe,
    • Diana E Benn,
    • Richard Lupat,
    • Jason Li,
    • Daniel Cameron,
    • Annette Hogg,
    • Shiva Balachander,
    • Ida Lm Candiloro,
    • Stephen Wong,
    • Bruce G Robinson,
    • Anthony T Papenfuss,
    • Anthony J Gill,
    • Alexander Dobrovic,
    • Rodney J Hicks,
    • Roderick Clifton-Bligh,
    • and Richard William Tothill
    TERT structural rearrangements in metastatic pheochromocytomas Endocr Relat Cancer ERC-17-0306, doi:10.1530/ERC-17-0306 first published on 3 October 2017
    ...TERT promoter mutations occur rarely in PC/PGL, we 35 hypothesized that other mechanisms - such as structural variations - may underlie TERT activation in 36 these tumors. From 35 PC and four PGL, we identified three primary PC that developed metastases 37 with elevated TERT expression, each of whic ~~~
  2. Review:
    • Jolanta Krajewska,
    • Ewa Chmielik,
    • and Barbara Jarząb
    Dynamic risk stratification in the follow-up of thyroid cancer: what is still to be discovered in 2017? Endocr Relat Cancer 24 (11) R387-R402, doi:10.1530/ERC-17-0270 first published on 18 August 2017
    ...TERT promoter mutations cooperatively identify the most aggressive papillary thyroid cancer with highest recurrence. Journal of Clinical Oncology 32 2718–2726. (doi:10.1200/JCO.2014.55.5094) Xing M, Liu R, Liu X, Murugan AK, Zhu G, Zeiger MA, Pai S & Bishop J 2015 Association between BRAF V600E muta ~~~
  3. Review:
    • Annunziata Di Domenico,
    • Tabea Wiedmer,
    • Ilaria Marinoni,
    • and Aurel Perren
    Genetic and epigenetic drivers of neuroendocrine tumours (NET) Endocr Relat Cancer 24 (9) R315-R334, doi:10.1530/ERC-17-0012 first published on 14 July 2017
    ...TERT promoter mutations occur frequently in gliomas and a subset of tumors derived from cells with low rates of self-renewal. PNAS 110 6021–6026. (doi:10.1073/pnas.1303607110) Kim DH, Nagano Y, Choi IS, White JA, Yao JC & Rashid A 2008 Allelic alterations in well-differentiated neuroendocrine tumors ~~~
  4. Research:
    • Eleanor L Woodward,
    • Andrea Biloglav,
    • Naveen Ravi,
    • Minjun Yang,
    • Lars Ekblad,
    • Johan Wennerberg,
    • and Kajsa Paulsson
    Genomic complexity and targeted genes in anaplastic thyroid cancer cell lines Endocr Relat Cancer 24 (5) 209-220, doi:10.1530/ERC-16-0522 first published on 24 February 2017
    ...TERT promoter mutations and validation of mutations Mutations in the BRAF gene were validated using a standard PCR and primers designed for exon 15 as previously reported (Davidsson  et  al. 2008): BRAFEx15 For: TGCTTGCTCTGATAGGAAAATGAG and BRAFEx15 Rev: TCTCAGGGCCAAAAATTTAATCA. Mutations in the pro ~~~
  5. Review:
    • Alfred King-yin Lam and
    • Nassim Saremi
    Cribriform-morular variant of papillary thyroid carcinoma: a distinctive type of thyroid cancer Endocr Relat Cancer 24 (4) R109-R121, doi:10.1530/ERC-17-0014
    ...TERT promoter mutations have been observed in thyroid carcinomas with aggressive biological behaviours. It is associated with tumour size, advanced stage, extrathyroidal invasion, lymph node metastases, distant metastases, BRAF mutation positivity, cancer recurrence and poor prognosis of patients wi ~~~
  6. Research:
    • Soomin Ahn,
    • Tae Hyuk Kim,
    • Sun Wook Kim,
    • Chang Seok Ki,
    • Hye Won Jang,
    • Jee Soo Kim,
    • Jung Han Kim,
    • Jun-Ho Choe,
    • Jung Hee Shin,
    • Soo Yeon Hahn,
    • Young Lyun Oh,
    • and Jae Hoon Chung
    Comprehensive screening for PD-L1 expression in thyroid cancer Endocr Relat Cancer 24 (2) 97-106, doi:10.1530/ERC-16-0421
    ...TERT promoter mutations were detected in 49 (12.0%) of 407 tested cases: 11.1% (n = 45) TERT C228T and 1.0% (n = 4) C250T mutations. TERT promoter mutations were detected in 9.8% (32 of 326) of papillary thyroid carcinomas, 16.7% (11 of 66) of follicular thyroid carcinomas, 33.3% (2 of 6) of poorly ~~~
  7. Review:
    • Fadi Nabhan and
    • Matthew D Ringel
    Thyroid nodules and cancer management guidelines: comparisons and controversies Endocr Relat Cancer 24 (2) R13-R26, doi:10.1530/ERC-16-0432 first published on 13 December 2016
    ...TERT promoter mutations in papillary thyroid microcarcinomas. Thyroid 25 1013–1019. (doi:10.1089/thy.2015.0101) Essig GF Jr, Porter K, Schneider D, Debora A, Lindsey SC, Busonero G, Fineberg D, Fruci B, Boelaert K, Smit JW, et al. 2013 Fine needle aspiration and medullary thyroid carcinoma: the risk ~~~
  8. Research:
    • Luca Morandi,
    • Alberto Righi,
    • Francesca Maletta,
    • Paola Rucci,
    • Fabio Pagni,
    • Marco Gallo,
    • Sabrina Rossi,
    • Leonardo Caporali,
    • Anna Sapino,
    • Ricardo V Lloyd,
    • and Sofia Asioli
    Somatic mutation profiling of hobnail variant of papillary thyroid carcinoma Endocr Relat Cancer 24 (2) 107-117, doi:10.1530/ERC-16-0546 first published on 6 January 2017
    ...TERT promoter mutations in familial and sporadic melanoma. Science 339 959–961. (doi:10.1126/science.1230062) Kakudo K, Bai Y, Liu Z, Li Y, Ito Y & Ozaki T 2012 Classification of thyroid follicular cell tumors: with special reference to borderline lesions. Endocrine Journal 59 1–12. (doi:10.1507/end ~~~
  9. Research:
    • Xiaopei Shen,
    • Rengyun Liu,
    • and Mingzhao Xing
    A six-genotype genetic prognostic model for papillary thyroid cancer Endocr Relat Cancer 24 (1) 41-52, doi:10.1530/ERC-16-0402 first published on 14 November 2016
    ...TERT promoter mutations in papillary thyroid cancer (PTC) has been recently established, but the role of RAS mutation in this genetic interplay remains to be established. Using The Cancer Genome Atlas (TCGA) data of patients with PTC from 19 medical centers, we investigated the interactions among th ~~~
  10. Review:
    • Vincenzo Marotta,
    • Concetta Sciammarella,
    • Annamaria Colao,
    • and Antongiulio Faggiano
    Application of molecular biology of differentiated thyroid cancer for clinical prognostication Endocr Relat Cancer 23 (11) R499-R515, doi:10.1530/ERC-16-0372 first published on 30 August 2016
    ...TERT promoter mutations in tumour progression (BornsteinQuevedo et al. 2003). Starting from the study by Liu and coworkers (2013), who firstly reported the mutations in follicular cell-derived thyroid cancers, a relevant body of research has been performed by 3 leading groups and by the TCGA, focusi ~~~
For checked items

Search Results

Next 10 » New Search

Modify Results

Citation format:
Results / page:
Results order:

This search

  • Alert me when new articles matching this search are published
  • Download all citations on this page to my citation manager

New Articles: issue in progress

  1. November 2017, 24 (11)
  1. Current Issue
  1. Alert me to new issues of Endocrine-Related Cancer

Most